|
Left Crispr |
Right Crispr |
| Crispr ID |
1105650439 |
1105650445 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:22371699-22371721
|
13:22371737-22371759
|
| Sequence |
CCCTTCCACCTATAAGCCTACAA |
AGTTACTTCCTAGATACAATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 17, 2: 190, 3: 1011, 4: 1456} |
{0: 1072, 1: 1588, 2: 1299, 3: 775, 4: 621} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|