|
Left Crispr |
Right Crispr |
| Crispr ID |
1105650439 |
1105650450 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:22371699-22371721
|
13:22371751-22371773
|
| Sequence |
CCCTTCCACCTATAAGCCTACAA |
TACAATGGGGGTACAGGCATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 17, 2: 190, 3: 1011, 4: 1456} |
{0: 505, 1: 1433, 2: 1785, 3: 1516, 4: 1175} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|