ID: 1105674215_1105674218

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105674215 1105674218
Species Human (GRCh38) Human (GRCh38)
Location 13:22652894-22652916 13:22652926-22652948
Sequence CCTGATAATGGTGCCATTAATCT AGACTTGAGCAGACTCTAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 96} {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!