ID: 1105674974_1105674978

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1105674974 1105674978
Species Human (GRCh38) Human (GRCh38)
Location 13:22661403-22661425 13:22661450-22661472
Sequence CCATATTACAAAAGATGCTGAAG ATACAGCAGGACAACCTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 330} {0: 1, 1: 0, 2: 1, 3: 7, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!