ID: 1105722962_1105722967

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1105722962 1105722967
Species Human (GRCh38) Human (GRCh38)
Location 13:23134852-23134874 13:23134877-23134899
Sequence CCCACTCTCTTGGTGGTGGGGAC TGCTCTCTGGGCTTTTGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 122} {0: 5, 1: 0, 2: 2, 3: 18, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!