ID: 1105723130_1105723145

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1105723130 1105723145
Species Human (GRCh38) Human (GRCh38)
Location 13:23135602-23135624 13:23135623-23135645
Sequence CCCATGATCCCCTCCCCCAAGAT ATGCTCTTCTTGGGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 21, 4: 223} {0: 1, 1: 0, 2: 2, 3: 29, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!