ID: 1105728153_1105728163

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1105728153 1105728163
Species Human (GRCh38) Human (GRCh38)
Location 13:23186139-23186161 13:23186181-23186203
Sequence CCCTGGCTGGTCTGAGTAGCCTT ACTCTGAAGGGTCTTAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 192} {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!