ID: 1105753608_1105753616

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1105753608 1105753616
Species Human (GRCh38) Human (GRCh38)
Location 13:23444648-23444670 13:23444687-23444709
Sequence CCAATGGAGTAAAGGACCCCAAT AAAAACAAGGAGAACTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 63} {0: 1, 1: 0, 2: 2, 3: 46, 4: 576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!