ID: 1105767310_1105767321

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1105767310 1105767321
Species Human (GRCh38) Human (GRCh38)
Location 13:23574690-23574712 13:23574734-23574756
Sequence CCCTTTAAAGGATGGTTCTTTAA CTCTGTGATGGGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 303} {0: 1, 1: 0, 2: 2, 3: 46, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!