ID: 1105775145_1105775153

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105775145 1105775153
Species Human (GRCh38) Human (GRCh38)
Location 13:23653080-23653102 13:23653112-23653134
Sequence CCAGCTTCCTGCCCCCTGTGCTA TAGACATCTGCTTCCCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 369} {0: 1, 1: 0, 2: 0, 3: 14, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!