ID: 1105775824_1105775828

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1105775824 1105775828
Species Human (GRCh38) Human (GRCh38)
Location 13:23659208-23659230 13:23659231-23659253
Sequence CCCAGCTGTAAGTTTTGAGCTCA TTACATTTCTTAGCATTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121} {0: 1, 1: 0, 2: 3, 3: 30, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!