ID: 1105790583_1105790585

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1105790583 1105790585
Species Human (GRCh38) Human (GRCh38)
Location 13:23794376-23794398 13:23794393-23794415
Sequence CCTTCCTCATATTGCTAACGCTG ACGCTGCCTTAACTCCCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68} {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!