ID: 1105804995_1105805002

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105804995 1105805002
Species Human (GRCh38) Human (GRCh38)
Location 13:23947441-23947463 13:23947473-23947495
Sequence CCCTCAGCACAGTGGGGGAGATG GTCCATTGGGAGCCGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 222} {0: 1, 1: 6, 2: 1, 3: 3, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!