ID: 1105810697_1105810711

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1105810697 1105810711
Species Human (GRCh38) Human (GRCh38)
Location 13:23992667-23992689 13:23992711-23992733
Sequence CCATGTGCTACAGCCCCTCCCTG GAGAGGGATCCTGCAAGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 350} {0: 1, 1: 0, 2: 1, 3: 19, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!