ID: 1105814293_1105814298

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105814293 1105814298
Species Human (GRCh38) Human (GRCh38)
Location 13:24020106-24020128 13:24020134-24020156
Sequence CCAGCTGCATACAGCTTCTCCCT CATGAAACACACCAACATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277} {0: 1, 1: 1, 2: 2, 3: 25, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!