ID: 1105827307_1105827316

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1105827307 1105827316
Species Human (GRCh38) Human (GRCh38)
Location 13:24134006-24134028 13:24134028-24134050
Sequence CCTTCCAGAGGTTGTGCTAAGTG GTGGTTGCTGGCGGGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 197} {0: 1, 1: 0, 2: 3, 3: 35, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!