ID: 1105830633_1105830647

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105830633 1105830647
Species Human (GRCh38) Human (GRCh38)
Location 13:24160814-24160836 13:24160854-24160876
Sequence CCAGGCTCCTCCGAGAGTGCGGC GGCACCGGAGGTGGCTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109} {0: 1, 1: 0, 2: 1, 3: 20, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!