ID: 1105830640_1105830647

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105830640 1105830647
Species Human (GRCh38) Human (GRCh38)
Location 13:24160839-24160861 13:24160854-24160876
Sequence CCTCGGGGCTCCGCCGGCACCGG GGCACCGGAGGTGGCTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 190} {0: 1, 1: 0, 2: 1, 3: 20, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!