ID: 1105845299_1105845303

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1105845299 1105845303
Species Human (GRCh38) Human (GRCh38)
Location 13:24288926-24288948 13:24288978-24289000
Sequence CCTACAAAAGCTGTACTATTCAA TATTACTTCTGTATTTTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 190} {0: 1, 1: 0, 2: 3, 3: 36, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!