ID: 1105848829_1105848831

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1105848829 1105848831
Species Human (GRCh38) Human (GRCh38)
Location 13:24316679-24316701 13:24316697-24316719
Sequence CCATACAGCTGCTGCTTATGCAT TGCATCTATATGACCTAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 178} {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!