ID: 1105857202_1105857210

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1105857202 1105857210
Species Human (GRCh38) Human (GRCh38)
Location 13:24384920-24384942 13:24384961-24384983
Sequence CCTCCATGAATCAGGAGGGCCAG GACCATGGTGCTAAGGTGGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 166} {0: 2, 1: 0, 2: 1, 3: 9, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!