ID: 1105864937_1105864948

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1105864937 1105864948
Species Human (GRCh38) Human (GRCh38)
Location 13:24451133-24451155 13:24451185-24451207
Sequence CCTCACTGAGGAAGGCATGAATA GAGCCCTGACCTGGGAGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167} {0: 1, 1: 2, 2: 6, 3: 51, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!