|
Left Crispr |
Right Crispr |
| Crispr ID |
1105869422 |
1105869428 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24491029-24491051
|
13:24491061-24491083
|
| Sequence |
CCTCCTGAGTTCAATAGATCCTC |
CCTCCAGAATTGTATTTGAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 482, 3: 9221, 4: 76181} |
{0: 1, 1: 0, 2: 1, 3: 15, 4: 194} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|