|
Left Crispr |
Right Crispr |
| Crispr ID |
1105878928 |
1105878940 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24586513-24586535
|
13:24586554-24586576
|
| Sequence |
CCAGTGATCTGCCCACCTCGGCC |
ACAGGCGGGAGCCACCATGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 90, 1: 455, 2: 1298, 3: 2426, 4: 3389} |
{0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|