|
Left Crispr |
Right Crispr |
Crispr ID |
1105878929 |
1105878940 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:24586524-24586546
|
13:24586554-24586576
|
Sequence |
CCCACCTCGGCCTCCCAAAGTGC |
ACAGGCGGGAGCCACCATGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 36192, 1: 181118, 2: 265840, 3: 185597, 4: 116247} |
{0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|