ID: 1105884322_1105884336

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1105884322 1105884336
Species Human (GRCh38) Human (GRCh38)
Location 13:24628971-24628993 13:24629017-24629039
Sequence CCATAAAGTGTGAACTTGGAAGG TGGGGATTGCCAAGACTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168} {0: 1, 1: 0, 2: 1, 3: 12, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!