ID: 1105889556_1105889565

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1105889556 1105889565
Species Human (GRCh38) Human (GRCh38)
Location 13:24672798-24672820 13:24672827-24672849
Sequence CCTTTTTTCCCCTCACATGAACC GGGTGTACTGAGTTTAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 234} {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!