ID: 1105892290_1105892300

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105892290 1105892300
Species Human (GRCh38) Human (GRCh38)
Location 13:24690360-24690382 13:24690388-24690410
Sequence CCGAGAAGAAGACCATCCCTTCA GCTGGTGGTGGGGGACATTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 163} {0: 1, 1: 0, 2: 4, 3: 71, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!