ID: 1105898357_1105898362

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1105898357 1105898362
Species Human (GRCh38) Human (GRCh38)
Location 13:24737016-24737038 13:24737059-24737081
Sequence CCATATCTAAACTTCGTAGGTCA GACACTGGGTTTCCTCCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81} {0: 1, 1: 0, 2: 0, 3: 49, 4: 1085}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!