ID: 1105898456_1105898463

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105898456 1105898463
Species Human (GRCh38) Human (GRCh38)
Location 13:24738227-24738249 13:24738255-24738277
Sequence CCAGGCCCAGTGCTGGGAGAAAG TCTGAAAAACCTGCTGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 388} {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!