ID: 1105898966_1105898978

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1105898966 1105898978
Species Human (GRCh38) Human (GRCh38)
Location 13:24740794-24740816 13:24740841-24740863
Sequence CCGATTTAGGGACCAGCTATGGG TAGGGTAACCAGAATGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59} {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!