ID: 1105916616_1105916627

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105916616 1105916627
Species Human (GRCh38) Human (GRCh38)
Location 13:24922863-24922885 13:24922903-24922925
Sequence CCCCCGTCCCGAGGTCCTGTGGG GCGCGTCTGCGCTAAAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150} {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!