|
Left Crispr |
Right Crispr |
| Crispr ID |
1105919659 |
1105919660 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24950170-24950192
|
13:24950193-24950215
|
| Sequence |
CCACGGACTGGGCGTGGTGGCTC |
ATGCCTTAATACCAGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 15, 2: 153, 3: 915, 4: 2697} |
{0: 4, 1: 111, 2: 359, 3: 1035, 4: 4068} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|