|
Left Crispr |
Right Crispr |
Crispr ID |
1105920900 |
1105920910 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:24962511-24962533
|
13:24962538-24962560
|
Sequence |
CCGCCTGTAATCCCAGCACTTCG |
GCCGAGGTGGGCAGATCACCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 37, 1: 1638, 2: 1906, 3: 1904, 4: 3774} |
{0: 81, 1: 3954, 2: 19186, 3: 49295, 4: 62756} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|