ID: 1105920905_1105920912

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1105920905 1105920912
Species Human (GRCh38) Human (GRCh38)
Location 13:24962522-24962544 13:24962545-24962567
Sequence CCCAGCACTTCGGGAGGCCGAGG TGGGCAGATCACCTGGCGTCAGG
Strand - +
Off-target summary {0: 1966, 1: 127622, 2: 277472, 3: 217223, 4: 239970} {0: 2, 1: 139, 2: 9151, 3: 29197, 4: 66070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!