|
Left Crispr |
Right Crispr |
| Crispr ID |
1105920905 |
1105920915 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24962522-24962544
|
13:24962572-24962594
|
| Sequence |
CCCAGCACTTCGGGAGGCCGAGG |
TGAGACCAGCCTTGCCAACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1966, 1: 127622, 2: 277472, 3: 217223, 4: 239970} |
{0: 296, 1: 35936, 2: 107540, 3: 174518, 4: 185662} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|