|
Left Crispr |
Right Crispr |
| Crispr ID |
1105920907 |
1105920910 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:24962523-24962545
|
13:24962538-24962560
|
| Sequence |
CCAGCACTTCGGGAGGCCGAGGT |
GCCGAGGTGGGCAGATCACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 559, 1: 38189, 2: 180898, 3: 257200, 4: 189119} |
{0: 81, 1: 3954, 2: 19186, 3: 49295, 4: 62756} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|