ID: 1105923391_1105923397

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1105923391 1105923397
Species Human (GRCh38) Human (GRCh38)
Location 13:24985192-24985214 13:24985230-24985252
Sequence CCCACAGCCATCTAGAAAAAATG TCATCGCTGCCTCCCTTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 382} {0: 1, 1: 2, 2: 0, 3: 15, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!