ID: 1105923391_1105923398

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1105923391 1105923398
Species Human (GRCh38) Human (GRCh38)
Location 13:24985192-24985214 13:24985233-24985255
Sequence CCCACAGCCATCTAGAAAAAATG TCGCTGCCTCCCTTCATAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 382} {0: 1, 1: 1, 2: 1, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!