ID: 1105926656_1105926661

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1105926656 1105926661
Species Human (GRCh38) Human (GRCh38)
Location 13:25014805-25014827 13:25014839-25014861
Sequence CCTCTCGGTGGGAGGGGCTCCAA AAGGGCCCTGAATATGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117} {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!