ID: 1105935433_1105935439

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1105935433 1105935439
Species Human (GRCh38) Human (GRCh38)
Location 13:25094268-25094290 13:25094314-25094336
Sequence CCAAGTGTATATTCCGTGGGCTG TGCCCATGAACACACCGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64} {0: 1, 1: 0, 2: 0, 3: 11, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!