ID: 1105939932_1105939943

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105939932 1105939943
Species Human (GRCh38) Human (GRCh38)
Location 13:25138828-25138850 13:25138877-25138899
Sequence CCTCCCGGGCAGCTGGGATTACA CTCTGTGTTTTTAGTAGAGATGG
Strand - +
Off-target summary {0: 12, 1: 1993, 2: 56816, 3: 227259, 4: 281254} {0: 1, 1: 190, 2: 12563, 3: 210854, 4: 144958}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!