|
Left Crispr |
Right Crispr |
Crispr ID |
1105939932 |
1105939943 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:25138828-25138850
|
13:25138877-25138899
|
Sequence |
CCTCCCGGGCAGCTGGGATTACA |
CTCTGTGTTTTTAGTAGAGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 12, 1: 1993, 2: 56816, 3: 227259, 4: 281254} |
{0: 1, 1: 190, 2: 12563, 3: 210854, 4: 144958} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|