|
Left Crispr |
Right Crispr |
| Crispr ID |
1105939935 |
1105939936 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:25138832-25138854
|
13:25138848-25138870
|
| Sequence |
CCGGGCAGCTGGGATTACAGGCG |
ACAGGCGCCCACCACCACACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 1322, 2: 29431, 3: 166292, 4: 322105} |
{0: 43, 1: 303, 2: 996, 3: 1980, 4: 3530} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|