|
Left Crispr |
Right Crispr |
| Crispr ID |
1105939940 |
1105939947 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:25138859-25138881
|
13:25138902-25138924
|
| Sequence |
CCACCACACTGGGCCAATCTCTG |
TTTCACCATGTCGGCCAAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 18, 3: 615, 4: 5942} |
{0: 26, 1: 3952, 2: 97691, 3: 165973, 4: 177042} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|