|
Left Crispr |
Right Crispr |
| Crispr ID |
1105939941 |
1105939946 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:25138862-25138884
|
13:25138893-25138915
|
| Sequence |
CCACACTGGGCCAATCTCTGTGT |
GAGATGGGGTTTCACCATGTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 3, 3: 58, 4: 866} |
{0: 39926, 1: 95780, 2: 131152, 3: 108291, 4: 62548} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|