ID: 1105943448_1105943460

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1105943448 1105943460
Species Human (GRCh38) Human (GRCh38)
Location 13:25170815-25170837 13:25170842-25170864
Sequence CCTCCTCTCCCCCTGCGGGCTCA CTGGGTCTCGCGGGGCGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 511} {0: 1, 1: 0, 2: 2, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!