ID: 1105943450_1105943462

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1105943450 1105943462
Species Human (GRCh38) Human (GRCh38)
Location 13:25170823-25170845 13:25170847-25170869
Sequence CCCCCTGCGGGCTCACCTGCTGG TCTCGCGGGGCGTCCTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 209} {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!