ID: 1105943459_1105943465

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1105943459 1105943465
Species Human (GRCh38) Human (GRCh38)
Location 13:25170838-25170860 13:25170867-25170889
Sequence CCTGCTGGGTCTCGCGGGGCGTC GGGCTCCTCCGGCTCGCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75} {0: 1, 1: 0, 2: 1, 3: 3, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!