ID: 1105975375_1105975377

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105975375 1105975377
Species Human (GRCh38) Human (GRCh38)
Location 13:25468485-25468507 13:25468500-25468522
Sequence CCATTGCTGCTGTCTCTGTTCCT CTGTTCCTAAGGAAGATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 613} {0: 1, 1: 0, 2: 3, 3: 22, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!