ID: 1105978256_1105978265

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105978256 1105978265
Species Human (GRCh38) Human (GRCh38)
Location 13:25492801-25492823 13:25492833-25492855
Sequence CCGCAGCCCCTGCTGTTTGGAGT AGGTGGGGCCCAGTTTCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 302} {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!